REVSYS: SYSTEMATICS OF THE
SCORPION FAMILY VAEJOVIDAE
HomeScorpionsVaejovidaeThe ProjectActivities/Products AcknowledgmentsLinks

 

Project Overview
Aims
Motivation
Intellectual Merit
Broader Impacts

Participating Institutions
AMNH
WTAMU
IBUNAM
CAS

Individual participants
Principal Investigators
Collaborators
Graduate Students
Undergraduate Students
High School Students
Technicians
Volunteers

Workplan
Fieldwork
Museum Collections
Databasing and Mapping
Taxonomy
DNA Sequencing
Choice of Gene Loci
Laboratory Protocols


Phylogenetic Analysis
Publications/Authorship

Timelines and Goals
Research Goals/Products
Training Program
Project Management

 

Laboratory Protocols

 

The AMNH Molecular Systematics Laboratory, where this aspect of the project is undertaken, currently includes two Applied Biosystems Inc. (ABI) PrismTM 3730xl automated DNA sequencers, a Biomek NX Laboratory Automation Workstation sequencing robot for automated PCR purification and sequence purification, three Eppendorf Mastercyclers, two MJ Research Tetrad 4-head and two Dyad MJ Research Thermocyclers for PCR.

The following standard protocols are routinely used for DNA isolation, amplification and double-stranded sequencing in the laboratory (Prendini et al. 2003):

Genomic DNA is isolated from the tissues using the Qiagen® DNeasy Tissue Kit Dneasy Protocol for Animal Tissues. Double-stranded template, suitable for sequencing, is prepared by PCR amplification with the primers listed in Table 1 (below). The 18S rDNA fragment is amplified in three overlapping sections, using the following primer pairs: 18S1F/18S5R, 18S3F/18Sbi, 18SA2.0/18S9R.  Primer pairs 28Sa/28Sbout, H3AF/H3AR, 12Sai/12Sbi, 16Sar/16Sbr and HCOoutout/LCO are respectively used to amplify fragments of 28S rDNA, H3, 12S rDNA, 16S rDNA and CO I. Amplification is conducted using Ready-To-Go PCR beads (Amersham Pharmacia Biotech), to which are added 1 μl per reaction of each 10 μM primer, 21 μl of water, and 2 μl of DNA. The PCR program consists of an initial denaturing step at 94°C for 5 min, 35 amplification cycles (94°C for 15 s, 49°C for 15 s, 72°C for 15 s), and a final step at 72°C for 7 min in a thermocycler. Specific conditions are optimized for taxa and primer pairs (e.g., a lower annealing temperature is used to amplify the CO I fragment).           PCR products are verified on 1% agarose/TBE electrophoresis gel, purified with AMPure (Agencourt®) magnetic beads, washing 2 times with 200 μl 70% ethanol before re-suspension in 40 μl RNase free water.

Double-stranded sequencing of the purified PCR products is conducted by the dideoxy termination method (Sanger et al. 1977) using an automated ABI PrismTM 3730xl DNA sequencer (Applied Biosystems). Cycle-sequencing of purified products is conducted with AmpliTaq® DNA Polymerase, FS (Perkin-Elmer) using dye-labelled terminators (ABI PrismTM BigDyeTM v.1.1 Terminator Cycle Sequencing Ready Reaction Kit) in a thermocycler. Cycle-sequencing is performed in an 8 µl reaction, consisting of 1 μl Big Dye, 1 μl Big Dye Extender Buffer, 1 μl 3.2 μM primer, and 5 μl purified PCR-product. The cycle-sequencing program consists of 25 amplification cycles (96°C for 15 s, 50°C for 15 s, 60°C for 4 min). Products are cleaned using CleanSEQ (Agencourt®) magnetic beads, washing with 85% ethanol before resuspension in 40 μl 0.5 mM EDTA. 96-well Microtiter plates are loaded with 33 μl of DNA+EDTA solution, before being placed in the automated sequencer.

    The accuracy of sequences is verified, in all cases, by independently amplifying and sequencing the complementary strands of fragments. If strands disagree considerably, the sample is reamplified and sequenced to resolve discrepancies. Chromatograms obtained from the automated sequencers are edited, primer sequences removed, and consensus sequences created from complementary strands using SequencherTM Ver. 4.5 (Gene Codes Corporation, Ann Arbor, MI).

 

Table 1.
Primers used in amplification and sequencing of vaejovid
DNA.

Primer name

Sequence (5'–3')

Other names (references)

18S1F

TACCTGGTTGATCCTGCCAGTAG

 

18S5R

CTTGGCAAATGCTTTCGC

 

18S3F

GTTCGATTCCGGAGAGGGA

 

18Sbi

GAGTCTCGTTCGTTATCGGA

 

18SA2.0

ATGGTTGCAAAGCTGAAAC

 

18S9R

GATCCTTCCGCAGGTTCACCTAC

 

28Sa

GACCCGTCTTGAAACACGGA

D3A (Nunn et al. 1996)

28Sbout

CCCACAGCGCCAGTTCTGCTTACC

 

H3AF

ATGGCTCGTACCAAGCAGACVGC

 

H3AR

ATATCCTTRGGCATRATRGTGAC

 

12Sai

AAACTAGGATTAGATACCCTATTAT

SR-N-14588
(Kocher et al. 1989; Simon et al.
1994)

12Sbi

AAGAGCGACGGGCGATGTGT

SR-J-14233
(Kocher et al. 1989; Simon et al.
1994)

16Sar

CGCCTGTTTATCAAAAACAT

LR-N-13398 (Simon et al. 1994)

16Sbr

CTCCGGTTTGAACTCAGATCA

LR-J-12887 (Simon et al. 1994)

HCOoutout

GTAAATATATGRTGDGCTC

 

LCO

GGTCAACAAATCATAAAGATATTGG

LCO-1490-J-1514 (Folmer et al. 1994)

Literature Cited

Folmer, O., Black, M.B., Hoch, W., Lutz, R.A. & Vrijehock, R.C. 1994. DNA primers for amplification of mitochondrial Cytochrome c Oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.

Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Pääbo, S., Villablanca, F.X. & Wilson, A.C. 1989. Dynamics of mitochondrial DNA evolution in animals: Amplification and sequencing with conserved primers. Proceedings of the National Academy of Sciences USA 86: 61966200.

Nunn, G.B., Theisen, B.F., Christensen, B. & Arctander, P. 1996. Simplicity-correlated size growth of the nuclear 28S ribosomal RNA D3 expansion segment in the crustacean order Isopoda. Journal of Molecular Evolution 42: 211–223.

Prendini, L., Crowe, T.M. & Wheeler, W.C. 2003. Systematics and biogeography of the family Scorpionidae Latreille, with a discussion of phylogenetic methods. Invertebrate Systematics 17: 185–259.

Sanger, F., Nicklen, S. & Coulsen, A.R. 1977. DNA sequencing with chain terminating inhibitors. Proceedings of the National Academy of Sciences USA USA 74: 54635468.

Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. & Flook, P. 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87: 651701.

 

 


The material included in this site is based upon work supported by the National Science Foundation under Grant No. 0413453.  Any opinions, findings, and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the National Science Foundation.
THE UNAUTHORIZED COPYING, DISPLAYING OR OTHER USE OF PHOTOGRAPHS OR OTHER CONTENT  FROM THIS SITE IS A ILLLEGAL. 
© Copyright 2005-2006.  All images in this site, even if they do not include an individual statement of copyright, are protected under the U. S. Copyright Act.  They may not be "borrowed" or otherwise used without our express permission or the express permission of the photographer(s),  artist(s), or author(s).  For permission, please submit your request to wsavary@yahoo.com.